VastDB

We have released a new batch of functional annotations (v11): 600 entries from previous publications investigating the function of AS events. This makes a total of 3637 entries directly from publications, 397 from CRISPR screens and 1511 from experimentally validated ELMs.

Cotyledon opening during seedling deetiolation is determined by ABA-mediated splicing regulation embopress.org/doi/full/10.10…

This sounds like a dream!! Barcelona and Berlin with amazing scientists and great people. Having worked with both groups I would highly highly (yes twice :) recommend it.

🐟Our new paper "Phenotypic impact of individual conserved neuronal microexons and their master regulators in zebrafish" is out in @eLife🐟 A nearly 10-year tour-de-force by Laura Lopez-Blanch and many others in the lab @CRGenomica & @UPFbiomed elifesciences.org/reviewed-prepr… Thread👇

🚨🚨🚨 If you're a bioinformatician who loves: 🧬 #SingleCell #LongReadSequencing & #AlternativeSplicing 🚀 Collaborating and travelling Apply to work with us at the spectacular @BIMSB_MDC in Berlin + @UPFbiomed-@CRGenomica in Barcelona. Qs:transdevolab.com Please RT!🙏

📢 We're hiring! We are looking for two excellent early career candidates to join #MELISupf as Junior Group Leaders in Computational Biology, and in Quantitative Biology More information and application links: upf.edu/web/biomed/job… Deadline: 28 Jan 2025 #JobOffer

Finally out nature.com/articles/s4158… the study (led by @xsalvatella1 & @RMendezLab) with the biophysical explanation for the profound effect of the microexon of CPEB4 as cause of autism, that we previously reported back in 2018 @ParrasAlbert @GeschwindLab @mirimiam @hervas_millan

Who would have thought that an actual sequence of a #microexon (GCAAGGACATATGGGCGAAGGAGA from CPEB4) would be in the headline of an article in @elpais_espana! Congrats to the Mendez, @xsalvatella1 and @JJLucasLab labs for this amazing work! english.elpais.com/science-tech/2…

We’re recruiting a PhD student to use comparative omics to investigate why some viruses can efficiently infect both human and mosquito cells, but lead to different infection outcomes. Fully funded position by @EvoMG_Bcn at UPF-CRG with the @ViroUPF lab. crg.eu/en/content/tra…

Circular RNAs trigger nonsense-mediated mRNA decay: cell.com/molecular-cell…

Come to the dark side! Join the #darkproteome team to work on plant functional annotation within our OSCARS @HorizonEU project FAIRFUN4Biodiversity. Great project, great advisor, great city and great team! 👇👇 @CsicLifehub

Thrilled to share this new work resulting from a great collaboration of my lab with the labs of @imaesomar and @veronica_hinman, started with the dear José Luis Gómez-Skarmeta many years ago. Take a look! biorxiv.org/content/10.110…

Big🧬news this week: we have launched the first Joint Program on Evolutionary Medical Genomics. Spearheaded by @mirimiam, Barcelona researchers will study and exploit the vast genomic diversity of life on Earth to enhance precision medicine. english.elpais.com/science-tech/2…

Great collaboration with @lrdesviat and @AndresenBrage to find ways to modulate inclusion of a microexon (CPEB4 exon 4) involved in autism! @sarapico7 @mirimiam @GeschwindLab @ParrasAlbert @RMendezLab @SENC_ @CBM_CSIC_UAM @CIBER_ISCIII

🎉Excited to announce that our paper on the blueprint of the human spliceosome is now out in @ScienceMagazine ! A decade of work with Juan Valcárcel and the incredible team at @CRGenomica to uncover the intricate roles of this essential RNA machinery.science.org/doi/10.1126/sc…

Out now: Using highly sensitive luminescence splicing reporters, we screened ~95,000 small-molecule compounds for modulators of neuronal microexons, a class of highly conserved alternative splicing misregulated in #autism & #NeuroendocrineCancer. 1/4 go.nature.com/3Wh6kp2

Published today! We found that cancer cells adapting to drug treatments don't simply switch from a sensitive to resistant state; instead there's a ‘resistance continuum’ of resistant phenotypes with epigenetically reprogrammed states. 🧵⬇️ nature.com/articles/s4158… @Gustavo_SFranca

🚨 We're excited to announce our Inaugural Symposium on Evolutionary Medical Genomics (EvoMG) at @the_prbb in Barcelona, November 20-22 2024. 👇Our great speakers and topics! Further info: evomedgenomics.com/events/inaugur… @CRGenomica @UPFbiomed @IBE_Barcelona

Very excited to announce the inaugural symposium of our @EvoMG_Bcn Joint Program on Evolutionary Medical Genomics! Join us in Barcelona on the 20th-22nd of November (no registration free). Great speakers and cool and diverse topics! @CRGenomica @UPFbiomed @IBE_Barcelona

The peer-reviewed version of our study on the evolution of tissue-specific expression across vertebrates and insects is finally published in @NatureEcoEvo ! @FedeMantica @CRGenomica @UPFbiomed nature.com/articles/s4155…

Job alert! We offer two positions (Team leader & Bioinformatics developer) to work on the Biodiversity Cell Atlas database: unified pipelines, data curation, and cross-species integration. With @irenepapatheodo @RodericGuigo @ExpressionAtlas @emblebi 🗓️Apr-10 🔗Details below