Sreelakshmi C

I had the incredible honor of spending time with Dr. Victor Ambros, co-recipient of the 2024 Nobel Prize in Physiology or Medicine. From sharing meals and meaningful conversations to introducing him on stage at UAB. Grateful beyond words! #NobelPrize #UAB @UABCDIB

🙏 Thank you @JASN_News for inviting me to contribute in the new format ‘innovator corner’. 💡Here I discuss how we came to the discovery of the Warburg effect and metabolic reprogramming in PKD. 💊And our attempts at translating this discovery into a therapy for patients.

The Song Lab at UAB’s School of Medicine invites applications for a gap year research position! Interested applicants can send their CV and statement to Dr. Jack Song at [email protected].

Combined lineage tracing and scRNA-seq reveal the activation of Sox9+ cells in renal regeneration with PGE2 treatment onlinelibrary.wiley.com/doi/full/10.11…

Show me a better come back video than this I will wait 🇮🇳 #Chandrayaan3 #IndiaOnTheMoon

Chandrayaan-3 Mission: 'India🇮🇳, I reached my destination and you too!' : Chandrayaan-3 @Chandrayaan3 has successfully soft-landed on the moon 🌖!. Congratulations, India🇮🇳! #Chandrayaan_3 #Chandrayaan3Landing #Chandrayaan3 #MoonLanding #india #VikramLander

@AJPRenal #ArticlesinPress: @2divyabhatia & Choi discuss the roles of #autophagy & #mitophagy in the #kidney in regulating inflammatory responses & during various pathological manifestations. ow.ly/ffRZ50OmQ9k @WeillCornell #KidneyInflammation #AcuteKidneyInjury #CKD

Now in print! 📗 Single cell RNA-seq and functional assays to examine monocyte-endothelial cell interactions in CKD. Transatlantic collaboration 🇮🇪🇺🇸 !!! @sarahcormican91 @mattgriffinneph @uniofgalway @WUTransplant

Well said #gradschool #UAB

This analysis of genome organization and gene activity with single-cell resolution using lineage tracing and single-nucleus multiomics offers new insight into regulation of renal injury repair bit.ly/JASN057 @HumphreysLab

Protocol: 1.Nasal swab into 100ul RNA shield on D2 2.RNeasy RNA isolation 3.iScript RT w/ AAACAGTTGCTGGTGCATGT 4.Phusion (touchdown from 65-62° 30” extension w/ TTTAACGCCACCAGATTTGC and CAGTTGCTGGTGCATGTAGAA) 5.Sequence w/ TGCTTGGAACAGGAAGAGAA and TGCATGTAGAAGTTCAAAAGAAAG